|
Thermo Fisher
gene exp ddb2 hs00172068 m1 ![]() Gene Exp Ddb2 Hs00172068 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-cell+targeted+dna+and+surface+protein+sequencing+analysis/Gene+Exp%2E+DDB2%2C+Hs00172068_m1/pmc11106736-23-76--1 Average 85 stars, based on 1 article reviews
gene exp ddb2 hs00172068 m1 - by Bioz Stars,
2026-09
85/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp chd7 hs00215010 m1 ![]() Gene Exp Chd7 Hs00215010 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-cell+targeted+dna+and+surface+protein+sequencing+analysis/Gene+Exp%2E+CHD7%2C+Hs00215010_m1/pmc09391418-66-23-24 Average 90 stars, based on 1 article reviews
gene exp chd7 hs00215010 m1 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
recombinant proteins tris hcl ![]() Recombinant Proteins Tris Hcl, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-cell+targeted+dna+and+surface+protein+sequencing+analysis/TRIS-HCL/pm41920741-247-93-101 Average 99 stars, based on 1 article reviews
recombinant proteins tris hcl - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Chem Impex International
glycerol ![]() Glycerol, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-cell+targeted+dna+and+surface+protein+sequencing+analysis/Glycerol/pmc07842297-62-133-134 Average 95 stars, based on 1 article reviews
glycerol - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
ATCC
sw480 ![]() Sw480, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-cell+targeted+dna+and+surface+protein+sequencing+analysis/SW480/pmc08997840-42-4-5 Average 99 stars, based on 1 article reviews
sw480 - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
hus1 ![]() Hus1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-cell+targeted+dna+and+surface+protein+sequencing+analysis/HUS1+Rabbit+mAb/pmc08104967-21-2-6 Average 94 stars, based on 1 article reviews
hus1 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
clic1 ![]() Clic1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-cell+targeted+dna+and+surface+protein+sequencing+analysis/CLIC1+Rabbit+mAb/pmc10663228-37-8-9 Average 93 stars, based on 1 article reviews
clic1 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
MedChemExpress
recombinant proteins empagliflozin medchemexpress ![]() Recombinant Proteins Empagliflozin Medchemexpress, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-cell+targeted+dna+and+surface+protein+sequencing+analysis/Empagliflozin/pm37751357-213-4-7 Average 96 stars, based on 1 article reviews
recombinant proteins empagliflozin medchemexpress - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
MedChemExpress
venetoclax ![]() Venetoclax, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-cell+targeted+dna+and+surface+protein+sequencing+analysis/Venetoclax/pmc09989506-47-0-2 Average 97 stars, based on 1 article reviews
venetoclax - by Bioz Stars,
2026-09
97/100 stars
|
Buy from Supplier |
|
Thermo Fisher
recombinant dna ![]() Recombinant Dna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-cell+targeted+dna+and+surface+protein+sequencing+analysis/DNA/pmc11446547-17-0-7 Average 99 stars, based on 1 article reviews
recombinant dna - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
thermo fisher
a11008 ![]() A11008, supplied by thermo fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-cell+targeted+dna+and+surface+protein+sequencing+analysis/Fluorescein/pmc09491365-10-0-9 Average 99 stars, based on 1 article reviews
a11008 - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
human cst protein ![]() Human Cst Protein, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-cell+targeted+dna+and+surface+protein+sequencing+analysis/Human+IL-6+Recombinant+Protein/pmc07559292-45-7-13 Average 93 stars, based on 1 article reviews
human cst protein - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Radiation research
Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
doi: 10.1667/RADE-22-00206.1
Figure Lengend Snippet: Overview of Participating Teams, Utilized Platforms, Number and Names of Genes or Gene Combinations Used, the Origin of Calibration Samples, and Further Details
Article Snippet: TaqMan assays SYBR Green assay , FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) , BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) , CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG , GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. , TaqMan ® assay: DDB2 (
Techniques: Generated
Journal: Radiation research
Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
doi: 10.1667/RADE-22-00206.1
Figure Lengend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams
Article Snippet: TaqMan assays SYBR Green assay , FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) , BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) , CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG , GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. , TaqMan ® assay: DDB2 (
Techniques: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Red Blood Cell Lysis, Control, Concentration Assay, Sequencing, cDNA Synthesis, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction
Journal: Radiation research
Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
doi: 10.1667/RADE-22-00206.1
Figure Lengend Snippet: The Table Depicts Team Contributions (from Left to Right) Regarding Employed Genes, Reported Dose Estimates per Reference Sample 1–3, Differences among Reported and Reference Dose-Values as well as the Summed Absolute Difference over all Reference Samples (SAD), a Correct (Yes) or Incorrect (No) Order of Dose Estimates (from Lowest to Highest) Corresponding to Three Dose Categories [Unexposed, Low (1.2 Gy) and Highly Exposed (3.5 Gy)], the Use of FDXR Gene Expression Changes for dose estimation, as well as the Report Time
Article Snippet: TaqMan assays SYBR Green assay , FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) , BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) , CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG , GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. , TaqMan ® assay: DDB2 (
Techniques: Gene Expression
Journal: Scientific Reports
Article Title: Improving the differentiation potential of pluripotent stem cells by optimizing culture conditions
doi: 10.1038/s41598-022-18400-8
Figure Lengend Snippet: The differentiation potential of cells in culture can be altered by culture medium. ( A ) H9 cells cultured with Essential 8 (Es8) medium on vitronectin-N (VTN)–coated dishes were transferred to RFF2 medium, cultured for 15 days (3 days/passage × 5 passages), transferred again to Es8 medium, cultured 24 days (3 days/passage × 8 passages), and then transferred again to RFF2 medium. Photos of cells in designated culture conditions, with the cell number scored at day 3 after seeding 1.0 × 10 5 cells (left panels); flow cytometric analysis of CHD7, CHD7 copy numbers from 5 ng total RNA at day 3 (middle panels); and photographs of EBs formed by day 14 from cells in each culture condition and numbers of EBs formed (right panels). The results are representative of three independent experiments. ( B ) H9 cells were cultured either with Es8 or RFF2 on VTN-N–coated dishes. The loci of copy number variants (CNVs) detected when cells were cultured with Es8 medium (left panels) or RFF2 medium (right panels) are shown. CHD7 expression was determined by flow cytometry (mean values are shown), and CHD7 copy numbers were determined by digital droplet PCR in cells cultured with Es8 or RFF2 medium.
Article Snippet: Briefly, cDNA was synthesized from 5 ng total RNA extracted from cells cultured with hPSCs or Es8 medium using TaqMan Gene Expression Assays (
Techniques: Cell Culture, Expressing, Flow Cytometry
Journal: Scientific Reports
Article Title: Improving the differentiation potential of pluripotent stem cells by optimizing culture conditions
doi: 10.1038/s41598-022-18400-8
Figure Lengend Snippet: Activation of mitochondrial function is coupled with differentiation. ( A ) Morphology, CellROX (ROX) immunostaining, CHD7 copy numbers, and mitochondrial membrane voltage (JC-1 assays) in cells cultured with Es8 medium on VTN-N–coated dishes (Es8/VTN) for 3 days (left panels) or with RFF2 medium on VTN-N–coated dishes (RFF2/VTN) for 3 days (right panels) are shown. Mitochondrial membrane voltage was assessed by subtracting baseline electrons (after depolarization) from total electrons (red circle). The percentage of each fraction in the scatter plot of JC-1 assays is shown. ( B ) H9 cells were cultured with Es8 or RFF2 medium, and culture medium was collected and replaced with fresh medium every day for 3 days. 2-Aminoadipic acid (2-AAA), malate, and citrate levels in culture medium were measured using LC–MS/MS. The measured values were standardized as the mean area ratio/cell/h for 3 days. The average values (n = 3) with error bars (SD) are shown in the bar graphs. The results of three independent experiments are shown. ( C ) Morphology, ROX staining, mitochondrial membrane voltage (JC-1 assays; red circle), and gene expression profiles (RT-qPCR score card panels) of H9 cells cultured with Es8 medium on VTN-N–coated dishes on day 5 (left panel: starting material for differentiation by Es6 medium) and Es6 medium on VTN-N–coated dishes on day 5 are shown (right panel). The interpretation of gene expression levels by RT-qPCR is shown in the attached table. The results of three independent experiments are shown.
Article Snippet: Briefly, cDNA was synthesized from 5 ng total RNA extracted from cells cultured with hPSCs or Es8 medium using TaqMan Gene Expression Assays (
Techniques: Activation Assay, Immunostaining, Membrane, Cell Culture, Liquid Chromatography with Mass Spectroscopy, Staining, Gene Expression, Quantitative RT-PCR
Journal: Scientific Reports
Article Title: Improving the differentiation potential of pluripotent stem cells by optimizing culture conditions
doi: 10.1038/s41598-022-18400-8
Figure Lengend Snippet: CHD7 expression affected the differentiation potential and growth of undifferentiated cells. ( A ) H9 cells cultured with Es8 on VTN-N–coated dishes (Es8/VTN, left panels) or with RFF2 on VTN-N–coated dishes (RFF2/VTN, right panels) were transfected with mock (control), mCHD7 , or siCHD7 . The morphology, CHD7 copy numbers, gene expression profiles (RT-qPCR), EB morphology, and EB numbers formed at day 14 under different culture conditions are shown. The representative results of three independent experiments are shown. ( B ) CHD7 expression in H9 cells determined by flow cytometry after cells were transferred from RFF2 to Es8 on VTN-N–coated dishes at passage 0 (P0), P5, and P7. Cells were cultured for 3 days between passages. ( C ) Fold increase of H9 cells after 48 h (upper panel) and CHD7 expression, as determined by RT-qPCR, after transfection of H9 cells with various doses of siCHD7 (lower panel). The average values (n = 3) with error bars (SD) are shown in the bar graphs. Representative data from three independent experiments are shown.
Article Snippet: Briefly, cDNA was synthesized from 5 ng total RNA extracted from cells cultured with hPSCs or Es8 medium using TaqMan Gene Expression Assays (
Techniques: Expressing, Cell Culture, Transfection, Control, Gene Expression, Quantitative RT-PCR, Flow Cytometry
Journal: Scientific Reports
Article Title: Improving the differentiation potential of pluripotent stem cells by optimizing culture conditions
doi: 10.1038/s41598-022-18400-8
Figure Lengend Snippet: Recloning of cells with differentiation potential based on culture conditions. ( A ) iPSC clones (201B7, PFX#9, SHh#2, or 253G1 cells) or ESC clones (H9 cells) were cultured either on feeder cells or on L511- or L521-coated dishes with iPSC or mTeSR1 medium. Clones were then transferred to Es8 medium and cultured on VTN-N–coated dishes. The mean and convergence of CHD7 expression of cell clones was determined by flow cytometry before (gray histogram) and after (red histogram) changing culture conditions. Representative results from three independent experiments are shown. ( B ) Flow cytometric analysis of cell clones for the mean and coefficient of variation (CV) measured before (circle) and after (square) changing culture conditions are plotted on the left panel and the differentiation potential before and after changing the culture conditions was assessed by the number of EBs formed and is shown on the right panel. The data set shown in ( B ) was generated from the same samples shown in ( A ).
Article Snippet: Briefly, cDNA was synthesized from 5 ng total RNA extracted from cells cultured with hPSCs or Es8 medium using TaqMan Gene Expression Assays (
Techniques: Clone Assay, Cell Culture, Expressing, Flow Cytometry, Generated
Journal: Cancers
Article Title: Folic Acid Treatment Directly Influences the Genetic and Epigenetic Regulation along with the Associated Cellular Maintenance Processes of HT-29 and SW480 Colorectal Cancer Cell Lines
doi: 10.3390/cancers14071820
Figure Lengend Snippet: ( a ) Cell proliferation and ( b ) cell viability alterations of HT-29 and SW480 colorectal cancer cell lines following different folic acid (FA) supplies. Sulforhodamine B (SRB) was used for cell proliferation detection (* p ≤ 0.05, *** p ≤ 0.001), while cell viability data were obtained by alamarBlue assay (** p ≤ 0.01). FA-depleted cells were kept in media containing 0 ng/mL FA, whereas treated cells were exposed to 100 and 10,000 ng/mL FA for 72 h. The percentages of cell proliferation and viability were given relative to samples kept in the normal growth media. FA: folic acid.
Article Snippet: HT-29 (ATCC HTB-39) and
Techniques: Alamar Blue Assay
Journal: Cancers
Article Title: Folic Acid Treatment Directly Influences the Genetic and Epigenetic Regulation along with the Associated Cellular Maintenance Processes of HT-29 and SW480 Colorectal Cancer Cell Lines
doi: 10.3390/cancers14071820
Figure Lengend Snippet: Genomic stability detection of HT-29 and SW480 cells exposed to different folic acid (FA) concentrations (0, 100, 10,000 ng/mL). ( a ) Micronucleus (MN) scoring was performed on DAPI- and anti-γ-H2AX-stained slides. Left: We obtained the results by proportioning the cells with MN with all cells counted (** p ≤ 0.01, *** p ≤ 0.001). Right: Representative γ-H2AX-positive micronuclei are indicated with arrows. ( b ) DNA integrity was evaluated with comet assay, additionally. Left: Graphs show the changes in genomic stability in consideration of comet tail DNA percentage (* p ≤ 0.05). Right: Characteristic comets of both cell lines were captured following different treatments. FA: folic acid.
Article Snippet: HT-29 (ATCC HTB-39) and
Techniques: Staining, Single Cell Gel Electrophoresis
Journal: Cancers
Article Title: Folic Acid Treatment Directly Influences the Genetic and Epigenetic Regulation along with the Associated Cellular Maintenance Processes of HT-29 and SW480 Colorectal Cancer Cell Lines
doi: 10.3390/cancers14071820
Figure Lengend Snippet: DNA methylation analysis of HT-29 and SW480 cell lines exposed to different folic acid (FA) concentrations. The methylation levels of long interspersed nuclear element 1 (LINE-1) CpG positions (pos 1, pos 2, pos 3) were ( a ) summarized and also ( b ) visualized individually to detect global DNA methylation changes. With the use of Reduced Representation Bisulfite Sequencing (RRBS) method, a genome-wide methylome profile of 10,000 ng/mL FA-treated cells was established in the comparison of cells kept in FA-free (0 ng/mL FA) media. ( c ) Firstly, the number of genes with altered methylation in the investigated CpG sites was assessed. “Hyper” and “hypo” sections indicate the number of genes with methylated and unmethylated CpG sites, respectively. The intersection of these two categories refers to the genes that possess both methylated and unmethylated CpG dinucleotides. ( d ) Heatmap shows the top 10 significantly ( p ≤ 0.05) enriched Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways with the number of differentially methylated genes. ( e ) Pie charts represent the localization of differentially methylated sites (DMS) in distinct chromatin states. FA: folic acid; pos: CpG position; hyper: hypermethylation; hypo: hypomethylation; DMSs: differentially methylated sites; heterochrom/lo: heterochromatin or low signal region; txn: transcription; CNV: copy number variation; KEGG: Kyoto Encyclopedia of Genes and Genomes.
Article Snippet: HT-29 (ATCC HTB-39) and
Techniques: DNA Methylation Assay, Methylation, Methylation Sequencing, Genome Wide, Comparison
Journal: Cancers
Article Title: Folic Acid Treatment Directly Influences the Genetic and Epigenetic Regulation along with the Associated Cellular Maintenance Processes of HT-29 and SW480 Colorectal Cancer Cell Lines
doi: 10.3390/cancers14071820
Figure Lengend Snippet: Genome-wide transcriptome alterations of HT-29 and SW480 cells following 10,000 ng/mL folic acid (FA) supplementation detected by Human Transcriptome Array 2.0 (HTA 2.0). ( a ) Pie charts represent the proportion of up- and downregulated genes. ( b ) Visual networks of protein–protein interactions were generated by the StringApp of Cytoscape software based on the list of genes with significant ( p ≤ 0.05) expression alterations and ≥|1.5| fold change (FC). Colors refer to the expression level of protein-coding genes (dark blue: FC ≤ −2, light blue: FC ≥ −2 and ≤−1.5, light red: FC ≥ 1.5 and ≤2, dark red: FC ≥ 2). ( c ) Top 10 genes showing significant ( p ≤ 0.05) up- and downregulation visualized with volcano plots. Gray points represent all the transcripts detected by HTA 2.0 microarray, while significantly ( p ≤ 0.05) altering genes with FC ≥ |1.5| value were marked with red and blue. P-val: p -value.
Article Snippet: HT-29 (ATCC HTB-39) and
Techniques: Genome Wide, Protein-Protein interactions, Generated, Software, Expressing, Microarray
Journal: Cancers
Article Title: Folic Acid Treatment Directly Influences the Genetic and Epigenetic Regulation along with the Associated Cellular Maintenance Processes of HT-29 and SW480 Colorectal Cancer Cell Lines
doi: 10.3390/cancers14071820
Figure Lengend Snippet: The intersection of genome-wide DNA methylation and gene expression data obtained by Reduced Representation Bisulfite Sequencing (RRBS) and Human Transcriptome Array (HTA) 2.0 analyses. Values represent the methylome and transcriptome pattern changes of 10,000 ng/mL folic acid (FA)-treated HT-29 and SW480 cells compared to non-treated samples (0 ng/mL FA). Only genes with promoter methylation status alteration in accordance with their expression level ( p ≤ 0.05 and fold change ≥|1.5|) were listed (left) and also visualized in volcano plots (right). Gray points represent all the transcripts detected by the microarray, while blue ones highlight down- and red ones show upregulating genes from the list. met. status: DNA methylation status; met. diff.: DNA methylation difference; expr. status: gene expression status; P-val: p -value.
Article Snippet: HT-29 (ATCC HTB-39) and
Techniques: Genome Wide, DNA Methylation Assay, Gene Expression, Methylation Sequencing, Methylation, Expressing, Microarray
Journal: eLife
Article Title: Co-regulation and function of FOXM1 / RHNO1 bidirectional genes in cancer
doi: 10.7554/eLife.55070
Figure Lengend Snippet:
Article Snippet: Antibody ,
Techniques: Magnetic Beads, Purification, Single Cell Gel Electrophoresis, Bicinchoninic Acid Protein Assay, DNA Methylation Assay, Gel Extraction, TA Cloning, Reporter Assay, Reporter Gene Assay, Plasmid Preparation, Software
Journal: Frontiers in Pharmacology
Article Title: Multi-omics analysis reveals CLIC1 as a therapeutic vulnerability of gliomas
doi: 10.3389/fphar.2023.1279370
Figure Lengend Snippet: The graphical abstract and analysis flow chart of present study. (A) Multi-omics data acquisition. Gliomas present high expression of CLIC1. (B) Prognostic implication of CLIC1 was investigated in gliomas. (C) Signaling pathways involved in CLIC1. (D) Experiments validated CLIC1 as a therapeutic vulnerability of gliomas. (E) Association of CLIC1 with drug sensitivity. (F) Anticancer immunity assessment of CLIC1.
Article Snippet: The following primary antibodies were used: β-actin (Proteintech,60008-1-lg),
Techniques: Biomarker Discovery, Expressing, Protein-Protein interactions
Journal: Frontiers in Pharmacology
Article Title: Multi-omics analysis reveals CLIC1 as a therapeutic vulnerability of gliomas
doi: 10.3389/fphar.2023.1279370
Figure Lengend Snippet: Upregulated CLIC1 correlates to undesirable prognostic outcomes of glioma. (A–C) Different OS, DSS and PFS outcomes in lowly and highly expressed CLIC1 patients as well as one-, three- and 5-year ROCs in TCGA cohort. OS, DSS and PFS analyses were conducted through Kaplan–Meier curves and log-rank test utilizing survival package. OS, overall survival; DSS, disease-specific survival; PFS, progression-free survival; ROC, receiver operating characteristic.
Article Snippet: The following primary antibodies were used: β-actin (Proteintech,60008-1-lg),
Techniques:
Journal: Frontiers in Pharmacology
Article Title: Multi-omics analysis reveals CLIC1 as a therapeutic vulnerability of gliomas
doi: 10.3389/fphar.2023.1279370
Figure Lengend Snippet: CLIC1 is linked with glioma patients’ clinicopathological traits. (A) Comparison of CLIC1 expression in glioma and normal tissues. (B–F) Comparison of CLIC1 expression in age <45 versus ≥45; male versus female; grade II (G2) versus grade III (G3); wild-type versus mutant IDH1; methylated versus unmethylated MGMT specimens. The Student’s t-test was used to compare the statistical difference between two groups. *** p -value < 0.001; ns: no significance.
Article Snippet: The following primary antibodies were used: β-actin (Proteintech,60008-1-lg),
Techniques: Comparison, Expressing, Mutagenesis, Methylation
Journal: Frontiers in Pharmacology
Article Title: Multi-omics analysis reveals CLIC1 as a therapeutic vulnerability of gliomas
doi: 10.3389/fphar.2023.1279370
Figure Lengend Snippet: Signaling pathways involved in CLIC1. (A) Enrichment of GO and KEGG pathways in high CLIC1 expression tumors. (B) Enrichment of GO and KEGG pathways in low CLIC1 expression tumors. (C) Correlation of CLIC1 with cancer-immunity cycle and well-established pathways.
Article Snippet: The following primary antibodies were used: β-actin (Proteintech,60008-1-lg),
Techniques: Protein-Protein interactions, Expressing
Journal: Frontiers in Pharmacology
Article Title: Multi-omics analysis reveals CLIC1 as a therapeutic vulnerability of gliomas
doi: 10.3389/fphar.2023.1279370
Figure Lengend Snippet: CLIC1 is a therapeutic vulnerability of glioma. (A,B) RT-qPCR for measurement of CLIC1 expression in U251 and U373 cells transfected with si-NC or si-CLIC1. (C) The protein level of the CLIC1 in glioma cells transfected with si-CLIC1 and a control sequence were assessed by Western blotting. β-actin was the loading control. (D–F) Flow cytometry for detection of apoptosis of si-NC or si-CLIC1-transfected U251 and U373 cells. (G–I) Wound healing for evaluation of cell mobility of si-NC- or si-CLIC1-transfected U251 and U373 cells. The Student’s t-test and one-way analysis of variance (ANOVA) were respectively used to compare the statistical differences between two groups and three or more groups. Bar, 200 μm. *** p -value < 0.001.
Article Snippet: The following primary antibodies were used: β-actin (Proteintech,60008-1-lg),
Techniques: Quantitative RT-PCR, Expressing, Transfection, Control, Sequencing, Western Blot, Flow Cytometry
Journal: Frontiers in Pharmacology
Article Title: Multi-omics analysis reveals CLIC1 as a therapeutic vulnerability of gliomas
doi: 10.3389/fphar.2023.1279370
Figure Lengend Snippet: Genomic alterations and DNA methylation associated with CLIC1. (A,B) Gene gains and losses in glioma tumors with upregulated CLIC1. Red, gains; blue, losses. The significant cutoff was set as q-value of 0.25. (C,D) Gene gains and losses in tumors with downregulated CLIC1. (E) Somatically mutant genes in highly or lowly expressed CLIC1 tumors. Genes are ranked by mutant frequency. (F–J) Different TMB, aneuploidy score, CTA score, fraction of genome altered and number of segments in two groups. (K) Correlation between CLIC1 methylation and its expression across glioma tumors. The Student’s t-test was used to compare the differences between two groups in terms of TMB, aneuploidy score, CTA score, fraction of genome altered, and the number of segments. The correlation between CLIC1 methylation and its expression across glioma tumors was assessed using the Spearman test. *** p -value < 0.001.
Article Snippet: The following primary antibodies were used: β-actin (Proteintech,60008-1-lg),
Techniques: DNA Methylation Assay, Mutagenesis, Methylation, Expressing
Journal: Frontiers in Pharmacology
Article Title: Multi-omics analysis reveals CLIC1 as a therapeutic vulnerability of gliomas
doi: 10.3389/fphar.2023.1279370
Figure Lengend Snippet: Association of CLIC1 with drug sensitivity. (A–G) Different IC50 values of (A) camptothecin, (B) cisplatin, (C) doxorubicin, (D) erlotinib, (E) etoposide, (F) paclitaxel and (G) rapamycin in highly and lowly expressed CLIC1 tumors. (H,I) Association of CLIC1 with AUC values of (H) CTRP- and (I) PRISM-derived drugs and different AUC values between down- and upregulated CLIC1 samples. The Student’s t-test was used to compare the statistical difference between two groups. *** p -value < 0.001.
Article Snippet: The following primary antibodies were used: β-actin (Proteintech,60008-1-lg),
Techniques: Derivative Assay
Journal: Frontiers in Pharmacology
Article Title: Multi-omics analysis reveals CLIC1 as a therapeutic vulnerability of gliomas
doi: 10.3389/fphar.2023.1279370
Figure Lengend Snippet: Upregulated CLIC1 associates with response to ICB. (A) Expression of immune checkpoints in lowly and highly expressed CLIC1 tumors. (B) Submap for evaluating the similarity in expression profiles between low or high CLIC1 expression samples and response to PD-1 or CTLA4 antibody. (C–F) Comparison of dysfunction, exclusion, IFNG and TIDE scores in tumors with up- and downregulated CLIC1. The Wilcoxon rank-sum test was used to compare the differences between two groups. ** p -value < 0.01; *** p -value < 0.001; ns, not significant.
Article Snippet: The following primary antibodies were used: β-actin (Proteintech,60008-1-lg),
Techniques: Expressing, Comparison
Journal: Frontiers in Pharmacology
Article Title: Multi-omics analysis reveals CLIC1 as a therapeutic vulnerability of gliomas
doi: 10.3389/fphar.2023.1279370
Figure Lengend Snippet: Single cell analysis of CLIC1 in Golima tumors. (A) Identification of cell types in line with well-established markers. (B) Expression distribution of CLIC1 in distinct cell types. (C) Proportion of high and low CLIC1 group in golima patients. (D) Proportion of high and low CLIC1 group in cell types. The landscape of golima’s intercellular communication between each cell type is represented by the thickness of the line, which symbolizes the number of ligand-receptor pairs (E) or interaction weight (F) . (G) Comparisons of inferred interactions in high and low CLIC1 group. (H) A barplot reveals the ratio of interaction strength between high and low CLIC1 groups for each signaling pathway. (I) Pathway exploration between high and low CLIC1 group through GSVA analysis.
Article Snippet: The following primary antibodies were used: β-actin (Proteintech,60008-1-lg),
Techniques: Single-cell Analysis, Expressing
Journal: Cell reports
Article Title: Oxidized mC modulates synthetic lethality to PARP inhibitors for the treatment of leukemia
doi: 10.1016/j.celrep.2023.112027
Figure Lengend Snippet:
Article Snippet:
Techniques: Purification, Blocking Assay, Recombinant, Lysis, Staining, Saline, DNA Methylation Assay, Enzyme-linked Immunosorbent Assay, Flow Cytometry, Binding Assay, Single Cell Gel Electrophoresis, Software, Protein Array, Membrane
Journal: eLife
Article Title: An anciently diverged family of RNA binding proteins maintain correct splicing of a class of ultra-long exons through cryptic splice site repression
doi: 10.7554/eLife.89705
Figure Lengend Snippet:
Article Snippet:
Techniques: Recombinant, Plasmid Preparation, Expressing, Construct, Stable Transfection, Sequencing, Single Cell Gel Electrophoresis, Software
Journal: Nature aging
Article Title: Characterization of cellular senescence in aging skeletal muscle
doi: 10.1038/s43587-022-00250-8
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: Goat anti-rabbit Fluorescein-conjugated secondary antibody Alexa Fluor 488 ,
Techniques: Western Blot, Plasmid Preparation, Variant Assay, Sequencing, Recombinant, Red Blood Cell Lysis, Reverse Transcription, RNAscope, Multiplex Assay, DNA Library Preparation, Sample Prep, Single Cell, Immunodetection, Avidin-Biotin Assay, Blocking Assay, Protease Inhibitor, DC Protein Assay, Membrane, Lysis, Isolation, Software